EST details — SGN-E334728

Search information 
Request: 334728Match: SGN-E334728
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C138208Clone name: cTOE-3-E19
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E334728Length: 266 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E334728 [] (trimmed) AACTAAAACCCTAGACTACTCTTTTGCTGAGCTAAGCAACAACGACTAGCCGGAAAATATGTCAGGCTTGAAGTTCGTCGCTGAAAGAACCGGTG
ATGGAGCTGGACAGCCATTCCTCGACACCGACAACGGCGAGGAACTCATGCATGTTCAACCTGGAACTGCCATAGTCCTCGGCAGCCGCCCTCCT
GAGTCTCCTGGCACTCTCTATATCACCTCCAAGCAAGTGGTGTGGCTAAGCGATACTGATAGGGGTAAAGGTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E334728] SGN-U568924 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T147850 [Download] [View] Facility Assigned ID: TAIAI34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0295 Quality Trim Threshold: 14.5