EST details — SGN-E335770

Search information 
Request: 335770Match: SGN-E335770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C136683Clone name: cTOE-19-I19
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E335770Length: 264 bp (1333 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E335770 [] (trimmed) CTCTGGCATGACTCAGGGAGGAAAGATTGACGCGCTACAAAGCTTTCAAGGAGGGTCATAAGAGAATTCCTTGTGGCAACTGATTTGGTTGGTAG
GGGCATTGACATTGAAAGGGTTAACATTGTTATTAACTATGACATGCCAGATTCTGCAGACACTTACCTTCACAGAGTGGGTAGAGCTGGTAGGT
TTGGGACGAAAGGCCTTGCCATTACATTTGTGTCCTCTGCGTCAGAATCTGAAGTTCTTAATCAGGTTCAGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E335770] SGN-U577313 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T151581 [Download] [View] Facility Assigned ID: TAICU58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0178 Quality Trim Threshold: 20.5