EST details — SGN-E335817

Search information 
Request: 335817Match: SGN-E335817
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C139016Clone name: cTOE-6-E10
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E335817Length: 282 bp (981 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E335817 [] (trimmed) ATGATACGAGTTGAAGCTTGTGATTATAACAAAAATAAAGCAATCTGGAGATCATACAGCTTTCTAGTCATTTTGCTCCGTAAATCATTGGTCAA
CAATATTTTCACCAGACTACCAACAGCATATATCAGAAAGGAGCACCTAAGAAAACACATAATCGGGGATACATTCAAATCGTTGATCAATTTGG
CACTATTAATACACTTCCTAGTCGCGGGCAGCATCTTCCAGTTCTTCATCCTCGGGTACACCACGAAGATAGAGGACATTGTTACATCTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E335817] SGN-U570986 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148694 [Download] [View] Facility Assigned ID: TAIAV29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0255 Quality Trim Threshold: 14.5