EST details — SGN-E336065

Search information 
Request: 336065Match: SGN-E336065
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135162Clone name: cTOE-12-K19
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336065Length: 551 bp (903 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336065 [] (trimmed) CAAAATCGAACAAACGAAAGTCAATTTGGCAATGGAGGTTCCAGGTTCATCGAAGAAGATGATTGCAACACAAGAAGAAATGGTGGAGAACAAAG
TGCCATTAGCATATAGGGATCAGTGCGCACACCTTTTGATCCCTTTGAACAAGTGTCGGCAATCGGAATTTTATCTTCCATGGAAGTGCGAGGAT
GAGCGCCATACATATGAGAAGTGTGCGTATGAGCTTGTTATGGAACGGATGCTTCAGATGCAGAAGATCCGTGAAGAGGAAGCACGAATGAAGCA
AAAGGGACATCAATCCATTCCTCTCATTCCTAAGACTGCTAATGCCTAGTTTTTTTTCCCATCATCTAGGGAGATGAAAAAATTGCCAATGTCTC
CAGAAACCAAGAGAATTATCAAATACTAGTTGGTGGATTTGTATTTGAAGTTGATTTCTGTTGAGTGATAAAGATGGTGTGGACTATTTGTAACC
TCTACCTGAATGCAAATAATGTTTTCTCATCAACAGTTTTTATGCTATTCTAAAACCAGTTTGATGATTTTTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336065] SGN-U568717 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T149981 [Download] [View] Facility Assigned ID: TAIBS70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5