EST details — SGN-E336147

Search information 
Request: 336147Match: SGN-E336147
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135180Clone name: cTOE-12-M3
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
See unigene SGN-U584698 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336147Length: 585 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336147 [] (trimmed) AAAAAAAATTGGGCTTATATTTTCGGTGGAATTCAATTCCTTTCATTTGGTTTCTCCTTTTTCTGGCTTACTTTTTTAAAATCTTATTCACACTT
CCACTGGAATGTTCCTCTGAACCTCTGTTTTGTAATTTTGACAAGTTTTTATTCTTGTTTAGAATGGTGGGGATATGGGTATCTTTAGTGTCATC
TCCGGTTCTTGGTACATGACCTACCTTCAAACTGAAAATTGATGCTTTGTACTGATTCATTTGGAAGTGTTTATTGCTTACCAGTTTTGGATTCA
TATAGCCAACTTCAACTTGTTTGGGATTGAGGCGTAGTTGTTGTACACCAGGGACAGGAAATTGTGTTATGGGTTGGTTAGAAAAGATATTTGGA
GGTTCCACACACAGGATCTCCGGTGGACAATACCATAGTGGGTATGAGGGTGCGCAATATCATGGGGGCTACGATGGAGGGCAATATCATTCGGG
GCATGAAGGAGAACAATATCATGGAGGGTATCAGGACAGTACTACTTGGGACGGACCAACTACATCAGTGGTAATCAGTGATTCTATTGCTAATT
GCTTTAAGTTGTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336147] SGN-U584698 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150063 [Download] [View] Facility Assigned ID: TAIBS74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0