EST details — SGN-E336456

Search information 
Request: 336456Match: SGN-E336456
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C138591Clone name: cTOE-4-M16
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336456Length: 361 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336456 [] (trimmed) ACATNNAAAAACAACTTCTCCCCTCATGAACCTTTTGGTCTGTTGTATAGCTTCTTCTGTTATCATTACAAGCAAGAAAATTCTTTACAGAGTGT
TTCTATCCTCTACTTATGTGATTACTGAAAGTGATGGTTCTGTTGTTTGAGTGCCAATCCAATGTGGATGGATTGAAACGAGTGGTACACAAAGT
ATTAGGCTTCTGGTTTGAATACAGTGATTGGTACAAATTCTACCAATTTTATATGTATTGCAGATAAGTTTCTGCCATTCTATGTCAAGGTTGGT
TTGGCGCTTCATAGTATTAATTTTGTTTTTTTTCTGCACCCAAATCCCCAAATTTGTTGCTAGAGGGGAAATTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336456] SGN-U568523 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148114 [Download] [View] Facility Assigned ID: TAIAN80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0202 Quality Trim Threshold: 12.5