EST details — SGN-E336603

Search information 
Request: 336603Match: SGN-E336603
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C138597Clone name: cTOE-4-M24
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336603Length: 339 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336603 [] (trimmed) GCTGAAATGTGACAATTTGCTTGTCAACTTAAAGGATCCTTCTCGACCCATTTGTAAGGTGGCTGATTTTGGGCTGTCAAAAATCAAGAGAAATA
CCTTCGTTACTGGTGGTGTCAGGGGAACGCTTCCATGGATGGCTCCAGAGCTATTGAATGGTGGAAGTAATAAGGTTTCCGAGAAGGTCGACGTC
TTTTCCTTTGGGATTGTGCTCTGGGAAATCCTCACTGGCGAAGAACCTTATGCAAATATGCATTATGGAGCAATTATAGGTGGTATTGTCAACAA
CACATTGAGACCGCCTGTGCCAAGCTTCTGTGACACTGAGTGGAGAATGCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336603] SGN-U577536 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148261 [Download] [View] Facility Assigned ID: TAIAN84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0169 Quality Trim Threshold: 12.5