EST details — SGN-E336816

Search information 
Request: 336816Match: SGN-E336816
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C138831Clone name: cTOE-5-J11
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336816Length: 320 bp (912 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336816 [] (trimmed) GCTTCTCTCTCTCAAAAAAATTGTGAAAATGGCTCTATCCATTCGTGTTCTTTGCTACTTGGTTTCTTGTAGCCATGCTTGATATGGCTACTGAA
ATGGGACCAACGAGAATCGTAGAGGCAAGACATTGTGAGTCGGTGAGCCATCGTTTCAAGGGACCATGTGTGAGCGATGAGAATTGTGCCTCTGT
TTGCGAGACCGAAAGATTTTCCGGTGGTAATTGCCGAGGATACCGTCGTCGTTGCTTTTGCACCAAGCCATGCTAAATAAATAATTTTGATTTTT
ATGTGTGGAAGAAGAAGTTTGATAAGAAAAAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336816] SGN-U581633 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148474 [Download] [View] Facility Assigned ID: TAIAS54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0312 Quality Trim Threshold: 12.5