EST details — SGN-E337006

Search information 
Request: 337006Match: SGN-E337006
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C136975Clone name: cTOE-20-J1
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E337006Length: 582 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E337006 [] (trimmed) GCTGCTACCGACAATGTCAACAATAACTCCGTTTCCAAGCCTTCTCTTTACCTTCAGAACATGGATGAGGTGCAGAAAGTGTTTCAACGGTTCGA
CACGAACGGCGACGGCATGATATCCGGCGAAGAGCTCTCCGGCGTCATCAGTGCTCTTGGATCTGGTACATCTCCTGAAGAAGTCTCTCGTATGA
TGAATGAAATTGATTCTGACAGAGACGGTTTCATTAGCCTTCAGGAATTTGCTGAGTTCTGTAAAGGCGACATTAACAGCATCGGTGACGGTGGC
GTTAGGGAGCTTCGTGAAGCGTTTGATCTGTACGATCAGGACAGTAACGGATTGATCTCCGCCGCTGAGCTTCATCAGATCCTGACTCGTTTAGG
CGAAAACTGCTCCGTTCAGGACTGTACCAAAATGATCAACTCCGTTGATTCCGACGGCGACGGTTACGTTAGCTTTGAAGAGTTTAAGAAGATGA
TGACTACCAGCAAGTAGGCTCTTTCTAGTCTTTGTTTTACTATCCCTTTTTAGCGGCTGATAAAGGTGAGGTGCACGGGATTATATTGCGTCCCC
TTTATAGGATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E337006] SGN-U579475 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T151599 [Download] [View] Facility Assigned ID: TAIDA49THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5