Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E337853

Search information 
Request: 337853Match: SGN-E337853
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135717Clone name: cTOE-14-O11
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E337853Length: 151 bp (770 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E337853 [] (trimmed) TTGCAAAGGGTGAGGTGCTGGGAGTACCGTCAACTCCCATCTATTGTCCGTGTCACCATGCCTACCCGTCCTGACAAGGCACGCCGATTGGGTTA
CAAGGCCAAGCAGGGCTATGTGGTCTACCGTGTTCGTGTGAAACGTGGTGGAAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E337853] SGN-U565717 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150409 [Download] [View] Facility Assigned ID: TAICA90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0029 Quality Trim Threshold: 20.5