EST details — SGN-E338249

Search information 
Request: 338249Match: SGN-E338249
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135468Clone name: cTOE-13-O17
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: Alias clone SGN-C186241 is on microarray TOM1: SGN-S1-1-2.4.5.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338249Length: 326 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338249 [] (trimmed) AGCCCAATGTACTTGAAAGGTTTCTGGAAAACAAAGATGACATTGCCAAACTACGGAAATGCTTTGCAGGGTTGTGGAGCTTGGATGAATCCGAC
ATTGTCAAGGATGCAATTGAGAGGCCTGAATTGTATGTTATGAAACCACAACGAGAAGGAGGAGGAAACAATATCTATGGGGAGGATGTCAGAAG
TGCTCTTTTGAAACTGCAAAAGGAAGGCACTGGAAGTGATGCANCCTACATACTAATGCAGAGGATTTTCCCGAAGATCTCTCACTCGATACTAA
TGCGAGAAGGCATCTCTCATAAAGAAGAAACCATATCAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338249] SGN-U575017 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150262 [Download] [View] Facility Assigned ID: TAIBW93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0220 Quality Trim Threshold: 14.5