EST details — SGN-E338355

Search information 
Request: 338355Match: SGN-E338355
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135370Clone name: cTOE-13-J12
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338355Length: 475 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338355 [] (trimmed) GACTCTCAGCAGATCGAGCAAAAATCAAAGGGGATGGCGCCGCCGAACACAGGATTAGCAGTGGGATTGAACAAAGGACACATTGTAACCAAGAA
GGAGTTAGCTCCACGCCCTTCTGACAGAAAAGGGAAAACCAGCAAAAGAATCCACTTCGTCAGGAGCCTCATCAGAGAAGTTGCTGGATTTGCTC
CATATGAGAAGAGGATTACTGAGCTTCTTAAAGTTGGTAAGGACAAGCGTGCATTGAAGGTAGCCAAGAGGAAGTTGGGTACCCACAAGAGGGCA
AAGAAGAAGAGAGAGGAGATGTCCAGCGTTCTCCGTAAGATGAGGGCAACCGGTGGTGGTGAAAAGAAGAAGTGAAGTCTCTATCCTTATTTTGA
CAATTGAGGAACTGAGTTTATTAGTTAATACATGATCTTTTTGAGTTAGCTATAAAATTCTCTAAACTTTGACACAATTATGGCTTTGAATTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338355] SGN-U580851 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150368 [Download] [View] Facility Assigned ID: TAIBZ54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0067 Quality Trim Threshold: 12.5