EST details — SGN-E338457

Search information 
Request: 338457Match: SGN-E338457
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C136035Clone name: cTOE-15-O10
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338457Length: 495 bp (683 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338457 [] (trimmed) GCTCATTCTTCAAACCCATCTTTCTCTTCTACACTTCTTGACGCAATTTACCGTTCAATTGATCAAGGAGAAGAAGAAGAAGAGATTGTTCTTTA
CAAAGAAACAATGCGTAAGAAACAGAGCAACAATATGGAGAGTTTTCAAAAAGCTTGTATGATTGAGAAATGGATGGAACATAAAGCAAGTGAAA
AAGTTGTTGTTCGAAGAAAATCTATAGCTGATTTCGAAAGGAATCTGATGAACTCGAGCTCGAGTTCTTCAGATTCGAGCTGTGGGGGTGTGTTT
TCTTCTTCAGAAACTGAATCCAGTTACAATAATGTAGTTATAAATTCTGCTGGGTCATCTTCTTCTTGTTATGGTCTAAACAGGCCTAAACCAAT
CAGAACCTCAATTTCCGGTTCAAACCCTGAAAAACACAGCAAAAATCAAGCTAAACAGCTCAACAACTATGGCGATTTCCGCCATAATCATCCTC
CTATGGAAAGAGATTTCGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338457] SGN-U573546 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150720 [Download] [View] Facility Assigned ID: TAICF89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5