Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E338730

Search information 
Request: 338730Match: SGN-E338730
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C137236Clone name: cTOE-21-O15
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
See unigene SGN-U565313 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338730Length: 264 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338730 [] (trimmed) TTCGGCACGAGGGTTTTATTGGCAATATTGTTACTACAACTCAACAAAATTTACAAAATAGACTAGTGGGAGATGATACTATTTGTAAATATTTG
GATAGGTATTTTGCAAATTACAAAGCAAAACACCAAGAAAAGCCAAAATGGTGTGTGGTTAGAGCTCAGATGATCTGTTGGCATATTCTTGAACC
AAAGCCCCAAAAAGTGAAGGCCTTTCCAGCAAATGAGATGGTTTGTCAAACTCTTTTGCTATTCCTGCATCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338730] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T151672 [Download] [View] Facility Assigned ID: TAIDC92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5