EST details — SGN-E338922

Search information 
Request: 338922Match: SGN-E338922
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C137052Clone name: cTOE-21-D2
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338922Length: 392 bp (797 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338922 [] (trimmed) GGTCACGTGAGAGTTATGGATGAATAACTTGAGAGGGGTGCTGATATCGATGCTCGAGCCAAGGGTGCATGTGCATGGACTCCTCTCCATCATGC
TGCGAAAGAGAAAAAGAAGAAAGCGATTAAATTCTTGATTAGAAATGGTGCATTTTTGCCAGATGACATCTCTGACACCAGGTTCAATCCACCAC
TTCACTATTGTCCTGGTCTTGAATGGGCATATGAGGAGATGAAGCTGCTTCAGCTAGAGAGTTCATCATCTGGCGAGGCCTCCTACAGCTCGGAA
AACTGAGGCAGAATCGAATGTGTTCCAAGTTTTGTTGGTGTGTAGAGTTCAAGATGGACTCCTCTCAATGTTATCTACTGCATATTAAGTAGTGT
CGTCAGTCTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338922] SGN-U563252 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T151864 [Download] [View] Facility Assigned ID: TAIDF13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0204 Quality Trim Threshold: 14.5