EST details — SGN-E339209

Search information 
Request: 339209Match: SGN-E339209
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147347Clone name: cTOF-4-I19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E339209Length: 398 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E339209 [] (trimmed) GCCAGTTGTAATAGTTTCAAAATTGAAGAAACTGTGTCACACTGAGATAGTATTGGTTGGACCAGCAAAAGAGCCGGAGAAGAAGAAAGATAATG
AGCCGAAGAAAACAGAAGACAAAAAGAAAGCGGCAGCGATAAAGGCATATCCAGCTCCAGTTCTCTATCAATATCAATATCAACAACCTTATCCA
CAGTACCCAACCCCTGTTCCTGCTTATCAGCACTATTACAGTGTGGAAGAGGACTCTAACTCTTGTGTGATCTGCTAGCTTCACATTTGTGATGA
GTTAGTGGACTAGTTCATACAAGCCTCCTTGTTGTACTATATTTGGTTGAAGAATTGAAATTTAAAGAGGATAATAAGCATTTGAAGCTGAAAAA
AATAAAAAGTTAGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E339209] SGN-U572795 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153468 [Download] [View] Facility Assigned ID: TOFAM58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5