EST details — SGN-E339756

Search information 
Request: 339756Match: SGN-E339756
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C136267Clone name: cTOE-16-J19
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E339756Length: 473 bp (1070 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E339756 [] (trimmed) ATTCGGCACCGAGGACCACCTGTTGTCATTCCCAAAATCCAACCCTTTTTACTCCTACTTTCCTCTATATTTCTTCCTTCTTCTTCTCCAAAAAA
AATTCTCCATAAAATTCTAAGCAAAACCCCATAAATTTTCTTTGATTTTTGAGTATTAATAACCATGGAAGCTGTGTTCAAAACCCAGAGTTTGT
TCTTGAAGTTATGGGGTTTGTTGGCAGTTGTTCTTGCTGTAGCTGTGGCTGTAAAGGGGAATTCAGAAGGGGATGCTTTGTCCCCCCTCCGCCGG
AGCTTATCTGACCCGGGTAACGTGTTACAGAGCTGGGATCCAAATCTTGTTAACCCTTGTACCTGGTTTCATGTCACTTGCAACGGAGATAATCA
AGTTACTCGTGTGGATCTTGGGAACTCAAAGTTATCTGGTCATTTGGTACCTGAGCTCGGAAAGCTTGAACATCTACAGTATCTGGAGCTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E339756] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T151228 [Download] [View] Facility Assigned ID: TAICK58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0120 Quality Trim Threshold: 20.5