EST details — SGN-E339909

Search information 
Request: 339909Match: SGN-E339909
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147067Clone name: cTOF-3-J15
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E339909Length: 536 bp (826 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E339909 [] (trimmed) GTTCAAATTAAAAATTTAGTAACATTCATTTCGAAACAGATTAAAAAAATAATAATGCGTATAAATTGCAAAGTAGAGAGTATCACGCTTTGATT
TGTTGTTTAAAGTAACTCGTACGTAACTAATATGATTTTATTTTCACAGAAATGGGACCAACGAGAATCGTAGAGGCAAGACATTGTGAGTCGTT
GAGCCATCGTTTCAAGGGACCATGTGTGAGCGATAAGAATTGTGCCTCGGTTTGCGAGACCGAAAGATTTTCCGGTGGTAATTGCCGTGGATTCC
GTCGCCGTTGCTTTTGCACCAAGCCATGCTAAATAAATAATTTTGATTTTTATGTGTAAAAGAAGAAGTTTGAGAAGAAAAAAAATATTATGTAA
TTTTGAATAAAGATGTATTGTAATGCTAGTTTTGTTTGTAAAAACTAGTTGTGATCTTTGAATTTGTATGCAATTATGGTGCACTAGACTTGTAA
TTCTTCATGTGGTGTATTTTTATTTTTATTTTTGAAATATTATAGATAAAATTTGTCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E339909] SGN-U581633 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153233 [Download] [View] Facility Assigned ID: TOFAK56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0