Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E340288

Search information 
Request: 340288Match: SGN-E340288
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C145622Clone name: cTOF-2-E19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181637 is on microarray TOM1: SGN-S1-1-6.4.12.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E340288Length: 600 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E340288 [] (trimmed) GGAGAAGCTTTGTTCAAATATGGCGAATCAAGGCATTGATACTTCATCTGCAAGAAAAGGCTCAATCACTCATGTAATCTTTGACATGGATGGAC
TTCTTCTAGACACCGAGAAATTCTATACGGAGGTCCAGGAGATTATACTTGCTAGGTATAATAAGACTTTTGATTGGTCACTCAAGGCAAAGATG
ATGGGGAAGAAGGCAATAGAGGCTGCCAGGGTCTTTGTTGAAGAGACAGGAATAAGCGATTCACTTACAGCCGAAGATTTTCTTGTAGAGAGAGA
GGAGATGTTGCAGAAAATGTTCCCCACAAGCGACCTCATGCCAGGGGCCAGCCGCTTGATTCATCACCTTCATGAAAATGGGATACCAATTTGTG
TTGCTACGGGTACTCACACACGGCACTTTGATTTGAAAACTCAAAGACACAGTGAACTTTTTTCACTAATGCATCATATCGTTCGTGGCGATGAT
CCAGAAGTTAAACAAGGGAAGCCATCACCTGATATATTCCTTGCAGCTGCGAACAGATTTGAGGGTGGAACAGTAGATCCACAGAGGATTCTTGT
ATTTGAAGATGCACCCTCTGGTGTCCTCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E340288] SGN-U573713 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153018 [Download] [View] Facility Assigned ID: TOFAE34THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5