EST details — SGN-E340735

Search information 
Request: 340735Match: SGN-E340735
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147564Clone name: cTOF-5-E15
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E340735Length: 701 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E340735 [] (trimmed) TTACCCGTCAAGCTCCAGCGAGACATCATTCTCTTGCCCTTTTCCCGGAGCCACTTCCCATCTCCTTCGCAGCTGATCCTCCCCATCTTCATCTC
CTCGCCGTCGAGAACAAATCTCCATCACCTACGTCTTCTATCTTCCATCTGTCTCCCCATCCATTTCATACACGAATAATTACTCATTTACACAC
CAATAGCTAATACTACGCGATCACTATCATATTTCATTGTTGTGTTCTCTTATTTGCTGGTTCGTGTTCGAGTGTGAGTTGGACCACGGATCCGT
GATGACTATAGCCGAGGGAAGCCTTTACAGAGGTCAATCACGGAGAGAGAAACCTAGAGGACGTAATCAGGGGTTAACTCAACAGAAAAGGCAAG
AAATAAGAGAGGCTTTTGAGCTTTTTGATACAGACAACTCTGGAACCATTGATGCCAAAGAACTCAATGTTGCTATGAGGGCTTTGGGTTTTGAA
GCGACTGAAGAGGAGATCAATCAAATGATTGCAGAAGTTGATAAGGATGGCAGTGGTGCAATTGATTTTGATGAATTTGTGCACATGATGACTGC
CAAGTTTGGAGAAAGGGACACTAAAGAAGAGCTCATGAAGGCATTTCACATTATTGATCAAGATAAAAATGGGAAAATATCTTTTGCGGACATTC
AAAGAATCGCTGATGAGTTGGGGGAGCGATTTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E340735] SGN-U568735 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153758 [Download] [View] Facility Assigned ID: TOFAQ32THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5