SGN ID: SGN-C147704 | Clone name: cTOF-5-L14 |  | Order Clone |
|
Library Name: cTOF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants
Microarray: Alias clone
SGN-C181731 is on microarray TOM1: SGN-S1-1-8.4.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E341028 | Length: 177 bp (829 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E341028 [] (trimmed)
GTTGAATTTGCACCAGAGTCACCAGCTGATATGGGTCAGGGCGAACCATATGGTTTACGATTATTGCACGGATAGCGCTAGGTTCCCTGTTGCCC
CTGTTGAGTGCCAGCACCACCAGCACAAGACGAATCATAACTAGGTGTGGAGGAAAATTGGAGTTCAGTCTTGCATTGTATA
[BLAST] [AA Translate]
SGN-ID: SGN-T154051 [Download] [View] |
Facility Assigned ID: TOFAT67TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 |
Expected Error Rate: 0.0000 |
Quality Trim Threshold: 12.5 |