EST details — SGN-E341028

Search information 
Request: 341028Match: SGN-E341028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147704Clone name: cTOF-5-L14
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181731 is on microarray TOM1: SGN-S1-1-8.4.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181731 [TUS-37-L17] Trace: SGN-T194060 EST: SGN-E392734 Direction: 5' Facility: INRA
Clone: SGN-C181731 [TUS-37-L17] Trace: SGN-T199292 EST: SGN-E397966 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E341028Length: 177 bp (829 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E341028 [] (trimmed) GTTGAATTTGCACCAGAGTCACCAGCTGATATGGGTCAGGGCGAACCATATGGTTTACGATTATTGCACGGATAGCGCTAGGTTCCCTGTTGCCC
CTGTTGAGTGCCAGCACCACCAGCACAAGACGAATCATAACTAGGTGTGGAGGAAAATTGGAGTTCAGTCTTGCATTGTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E341028] SGN-U580834 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T154051 [Download] [View] Facility Assigned ID: TOFAT67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5