EST details — SGN-E343486

Search information 
Request: 343486Match: SGN-E343486
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C142309Clone name: cTOF-19-I9
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E343486Length: 428 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E343486 [] (trimmed) GGTGAGTTCTGCAAAAGTAGGGTTTTCTTGCAAACACATCGCGCAGCCTCGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACC
CAAAGAACTACGGCCCTGGCTCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGC
TTCCGCAGCAATGCCAAGGAAATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAG
AAGACATATGGCATTAGAGCTTTTTGATTTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTGATTTATGTTTTAACTTTTGGAAGTA
ACTGCTATGTGAACCTAAGAAAGACTAGCTTTTAAGATTTTAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E343486] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T157702 [Download] [View] Facility Assigned ID: TOFCU53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5