EST details — SGN-E343889

Search information 
Request: 343889Match: SGN-E343889
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140651Clone name: cTOF-12-P19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C184608 is on microarray TOM1: SGN-S1-1-3.4.14.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184608 [TUS-45-D14] Trace: SGN-T198784 EST: SGN-E397458 Direction: 3' Facility: INRA
Clone: SGN-C184608 [TUS-45-D14] Trace: SGN-T198785 EST: SGN-E397459 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E343889Length: 645 bp (878 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E343889 [] (trimmed) GCCGCTTCATTTGGCTGCAAGAGGTGGTTCTCTTGATTGCATCCGTGAATTGTTGGCGTGGGGAGCAGATCGATTACATAGAGATTCCACCGGGA
GAATACCATACACGGTTGCTTTAAGGTACCACCATGGTGCTTGTGCAGCTTTGTTGAATCCTTCATCGGCAGAGCCTCTCGTGTGGCCATCGCCG
TTGAAGTTCATTAGTCAGCTCAATGATGAGGCGAAAGCCTTGCTAGAACGTGCGTTAATGGAAGCGAATAAGGAGAGGGAAAAAAATATCTTAAA
GGGTACAGATTACTCTCCACCTTCCCCATCACAATCTGATGCAGGGATGGATGACAACATGTCTGAGGTCAGTGATACGGAAGTATGTTGCATCT
GTTTTGATCAATTATGCACAATTGAAGTCCAGGACTGTGGGCACCAGATGTGTGCACATTGTGTACTGGCCTTATGCTGCCACAACAAGCCAAAC
CCGACCACGACTAGTCCACCAGAACCCGTGTGCCCATTCTGCAGAAGCAACATTGTACAGTTACAAGCTATCAAGGTCACAAAGAACAATGACAC
AGATTTCTGATCTCCACTCCTCAAAACTTCGAAAGACTAGGAGATCACGAAACTTCAGCGAGGGCAGNCAGTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E343889] SGN-U579194 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T155846 [Download] [View] Facility Assigned ID: TOFBU94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5