EST details — SGN-E343921

Search information 
Request: 343921Match: SGN-E343921
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140575Clone name: cTOF-12-L24
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181833 is on microarray TOM1: SGN-S1-1-2.4.12.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E343921Length: 701 bp (866 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E343921 [] (trimmed) GATTTACTTCTATACTCTCATTTTCACCAAGAAAATCAAGCATGGCCAAGATTGTTTCAGTTCTCCTTTTGGCCCTTCTTGTCATTTCCATGCTT
GCTAACACTGTTATGGCTGCAAATGGCAAACACCACCACTATGCTAAGAAGTTATGGACCAGGAAGCTTGAAGCCCTCGCAATGTCTACCACAAT
GTACGAGGAGGTGTAGCAAGACACAGTACCACAAGCCATGCATGTTCTTCTGCCAAAAATGTTGCAACAAGTGTTTGTGTGTTCCACCTGGTACC
TATGGAAACAAGGCTGTTTGTCCTTGTTACAATAACTGGAAGACCAAGGAAGGAGGACCTAAATGCCCTTAATTTACTTTCTGTTTTCATCTAAT
ATGTCTACCTAATCTTCTTGTTTTTTCTCCTATTGCACTTTTATCTAACCCAAGTGGTTATATATGTAATATGACCATATTTCCAGAGTTTAAAT
GGAACAAAAATATCACTCCCACTCTTGCTAGAAAGTTTAATCTTCCTTTGGACCAAACAAATTTCCATCTTTCCTCATTAAAAAAAAAAAAAAAA
AAAACTCGAGTTTATTTTTTATTTTGCATTGAGATAAGAAAATGTTGATCACACAAAATTTTATCAATTACTATTCTTCATCTAACAATTTTTCT
TATATTTTTTTGAGATATAGAAAAAAAAAGATTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E343921] SGN-U569289 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T155878 [Download] [View] Facility Assigned ID: TOFBV72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5