EST details — SGN-E344041
Search information |
Request: 344041 | Match: SGN-E344041 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C140537 | Clone name: cTOF-12-J7 |
| ||
Library Name: cTOF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E344041 | Length: 106 bp (880 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E344041 [] (trimmed)
GCTTTGAATAATATGGATGTGAGTGGTGAGTATGCATTGAAATACGGCATGAGATTGAAGAACAATGTGCTGAGGTGTTTTCTGCACCAGCAGAT
AGAGAGAGGGT
AGAGAGAGGGT
Unigenes |
Current Unigene builds | |||||
[SGN-E344041] | SGN-U584770 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T155998 [Download] [View] | Facility Assigned ID: TOFBU52TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.947 | Expected Error Rate: 0.0478 | Quality Trim Threshold: 14.5 |