EST details — SGN-E344059

Search information 
Request: 344059Match: SGN-E344059
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140662Clone name: cTOF-12-P7
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
See unigene SGN-U582445 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E344059Length: 725 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E344059 [] (trimmed) GAAAAATGAAGCCCTCCTCTATAGTTTCCATTCTCTCTTTTTCCCTCTTCTTTCTCTCTCAAATCTCTCCATCTCTTTCAGCTGAAAGATGTCAC
CCAAATGACAAAAAAGCCCTCCTAGAATTCAAAAAAGCTCTGGGTAATCCTGATGATTTGGGTAATTGGAATCCCAAAACTGATTGCTGCATTGA
CTGGTACGGACCTACTCTCGAATGCGATGAAAAATCGAACCGGATTAATCTCATCGATTTCTCCAAAATGAATCTCTCTGGATATCTCTCTCCCG
CCATCGGAGATCTCACATACCTTACGAAATTCAGTATCCACAATGTACGTAATCTCACCGGTCCAATTCCATCAACAATTGTTAAGCTCACGAAT
CTCAATTTCTTCAGAATTAGTGAATCGGACATTTCAGGACCAGTACCTGAAGTCCTTAGTAAATTGAAAAGCTTAACGTACATTAATTTGTCGTA
TAATAAGCTTGTTGGAACTATCCCAGCCTCGCTATCGCAACTTCCATATTTGGAATTTTTACGATTAGATAGGAACAAATTGACTGGACCAATAC
CGGNAGTCGTTTAGCAAATTAGCTCCCAATTTAACGTATCTTTACCTTGGGCATAACCAACTTACAGGGGATTGTACCAATTTCATTTGCTGGGG
TGGAGTTTTGACACAATTGNATTTGTCAAGGAACATGCTTGAAGGGGGATATTTCGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E344059] SGN-U582445 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156016 [Download] [View] Facility Assigned ID: TOFBU88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5