EST details — SGN-E344080

Search information 
Request: 344080Match: SGN-E344080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140561Clone name: cTOF-12-L10
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E344080Length: 505 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E344080 [] (trimmed) GATTTACTTCTATACTCTCATTTTCACCAAGAAAATCAAGCATGGCCAAGATTGTTTCAGTTCTCCTTTTGGCCCTTCTTGTCATTTCCATGCTT
GCTAACACTGTTATGGCTGCAAATGGCAAACACCACCACTATGCTAAGAAGTATGGACCAGGAAGCTTGAAGCCCTCGCAATGTCTACCACAATG
TACGAGGAGGTGTAGCAAGACACAGTACCACAAGCCATGCATGTTCTTCTGCCAAAAATGTTGCAACAAGTGTTTGTGTGTTCCACCTGGTACCT
ATGGAAACAAGGCTGTTTGTCCTTGTTACAATAACTGGAAGACCAAGGAAGGAGGACCTAAATGCCCTTAATTTACTTTCTGTTTTCATCTAATA
TGTCTACCTAATCTTCTTGTTTTTTCTCCTATTGCACTTTTATCTAACCCAAGTGGTTATATATGTAATATGACCATATTTCCAGAGTTTAAATG
GAACAAAAATATCACTCCCACTCTTGCTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E344080] SGN-U569289 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156037 [Download] [View] Facility Assigned ID: TOFBV65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5