EST details — SGN-E344178
| Search information |
| Request: 344178 | Match: SGN-E344178 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C141395 | Clone name: cTOF-16-F5 |
| ||
| Library Name: cTOF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E344178 | Length: 192 bp (891 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E344178 [] (trimmed)
GGGCAATGGGAAAGCGAGGAAGACAACCCAAACAAGTTCTTAAATTCTAAGTCACGGGTACTTCAACATTATTCTAATTTGAGTGCTGTAAGCAT
AAGCTTTGTTGTTAGACAAGCCAGTTTAGGTAAATGTATCCCCAAGAAATAATAAGACAATTGGCAGTGCCACTCGTTGTGGCATCTATTCTCCT
TT
AAGCTTTGTTGTTAGACAAGCCAGTTTAGGTAAATGTATCCCCAAGAAATAATAAGACAATTGGCAGTGCCACTCGTTGTGGCATCTATTCTCCT
TT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E344178] | SGN-U562656 | Tomato 200607 | Build 2 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T156765 [Download] [View] | Facility Assigned ID: TOFCK27THB |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.882 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |
Working
