EST details — SGN-E344209

Search information 
Request: 344209Match: SGN-E344209
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141585Clone name: cTOF-16-P5
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E344209Length: 585 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E344209 [] (trimmed) GAGGCTAGAATTTCCCAATGGCTTCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTC
ACTGGACTCAAGTCCACCGCTTCTTTCCCTGTTTCAAGGAATTTTTTTTTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCAT
GCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACC
TATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGC
AGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACA
GGCATGGGTCCGTATCATCGGATTCGACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGGTTACAAGCCCGAAAGATACTAAGTTCTAGAAA
AACTAATTGCCCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E344209] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156796 [Download] [View] Facility Assigned ID: TOFCK87THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0044 Quality Trim Threshold: 20.5