EST details — SGN-E344320

Search information 
Request: 344320Match: SGN-E344320
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141320Clone name: cTOF-16-B19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E344320Length: 702 bp (876 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E344320 [] (trimmed) GCATTAACAAAAGAAGATGGAGAAGTTGAACAGCATTTTCAAGAAGAAGACTTCACCAAAAGAAGCATTGAGGACCAGCAAAAGGGAAATGGCTG
TTGCTACCAGAGGCATTGAACGGGAGATCTCATCCTTACAAATGGAGGAGAAAAAGTTAGTTGCAGAGATCAAGCAAACAGCCAAAACTGGAAAT
GAGGCCGCCACCAAAATTCTAGCTCGTCAACTTGTGAGATTGCGGCAACAAATTGTCAATTTGCAAGGTAGTCGTGCTCAAATTAGGGGTGTAGC
AACTCATACACAGGCACTATATGCTAGCACCTCTATGTCTACTGGAATGAAAGGTGCAACTAAAGCGATGTCTGCCATGAACAAGCAAATGGCAC
CTGCAAAACAAGTTAAAGTGATCAGAGAATTCCAGAAGCAGTCATCACAGTTGGACATGACAATTGAGATGATGTCCGAATCCATTGATGAGACT
TTGGATAAAGATGAAGCTGAAGAAGAAACTGAGGAGCTTACAAACCAGGTGCTGGACGAGATTGGTGTGGACATTGCATCACAGTTATCTTCAGC
TCCAAAAGGCCGGATTGCATCAAAGACAGTTGAAAATGTTGCCCCTCCTAGTTCTGATACTGCTGCAGATGTCGAGGAACTTGAGAAAGAGGTGG
CCTCTCTTCGAAGAATTTGATGAAGAAACGTGGACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E344320] SGN-U573747 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156907 [Download] [View] Facility Assigned ID: TOFCK10THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5