EST details — SGN-E344465

Search information 
Request: 344465Match: SGN-E344465
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141273Clone name: cTOF-14-O6
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E344465Length: 339 bp (888 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E344465 [] (trimmed) GGTGGGCCCATTTCGTGCCGATTGTGACGGCCGGAGGCGGAGGAAGATCGTCGACGGTGTCGGGATTGACGACGGAGGAGCGATCTTCTGACCGG
GAAGCTCGTTCGCCGGCGACTAAGCGTGCTCGAAATGATCGCCAGTCTGTTTCAGTGAAAGGCCTTTCTTCATCTTGAGGTGAAGGTGATGGCAA
TGGTGAACTTGCCTGGCAACCTACAAGTATCAAAATTTTCTTAATATATGTTTATCTGATCATCTTTTATAGCTTAATTTGAAAATTACCTGAAA
ATCTGTTTCATTTTACAGTATGTGCCAAAATTTATGTGATTCAAAATGTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E344465] SGN-U565541 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156443 [Download] [View] Facility Assigned ID: TOFCB87THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5