EST details — SGN-E344695

Search information 
Request: 344695Match: SGN-E344695
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141247Clone name: cTOF-14-N22
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181478 is on microarray TOM1: SGN-S1-1-5.2.12.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181478 [TUS-37-B4] Trace: SGN-T194256 EST: SGN-E392930 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E344695Length: 707 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E344695 [] (trimmed) GGTTCCTTCAGGACTTTTCGATAAAGATTTGGATGCGTTGTTTTTGAATGACAATAGATTCCGTTTTGGCATCCCGGAGAACTTGGGTAACTCTC
CTGTTTCGGTTCTTGTGTTTGCTAATAACGATCTTGGAGGGTGTATTCCCGCAAGTATTGGGAAAATGGGGAAAACGTTGAATGAGTTGATATTG
ATGAATGATAACCTCACTGGGTGTTTGCCAATGGAGATTGGATTGTTGAACAAGTTAACCGTGTTTGATGTTAGCTTCAACAAGATTCAAGGCTC
ATTGCCATCAACTGTGAGCAAAATGAGGAGTGTGGAGGAACTGAATGTGGCTCACAACAAGCTTACTGGGGTTATACCAGCTAGCATTTGCCAAC
TTCCTAGGTTGCAAAACTTTACGTATTCCTTCAATTACTTCACCGGGGAAGCTCCAGTTTGTGCTGCGACTAGATCTGGTGACGGCCAGGAGAAC
TGTATCGTTGGAAAGAAGAATCAAAGATCTGCTAAAGAATGCTCTTCGGATGATGCAAAACCGTATGATTGTAGGAAATCCAAGTGTTATAGCCC
TTTTGCTACATCTCCTTCGACAAAGCCAAAACCAAAACCAAAGCCAAGAGGCCCACCACCACCTACTTGGAAGTCTTCGGGTTCGCATAACAAGC
GATCTCCGNCGCCACCTAAATCAACTCCTCTTCCTTCACCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E344695] SGN-U579359 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156673 [Download] [View] Facility Assigned ID: TOFCD83THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5