EST details — SGN-E345275

Search information 
Request: 345275Match: SGN-E345275
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140924Clone name: cTOF-13-N13
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E345275Length: 650 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E345275 [] (trimmed) AGTTGCCAAGATCTGCGATTTTTCTGAGTAGATCTGTTGGCGGGGTTTGTTGAAAAAGATTCAATTTTGATCTTGTTTAGAGAAAAGATGACTAT
ATTCAGGCTTGCTGGGGATATGACCCATTTGGCTAGTGTTCTTGTTTTGCTTCTCAAGATCCATACTATCAAATCTTGTGCTGGTGTTTCTCTGA
AGACGCAAGAGCTATATGCTCTTGTCTTTGTTACTCGCTACTTGGACATATTTACAGACTTTATTTCACTATACAATACTACAATGAAGTTGGTT
TTCTTGGGAAGCTCTTTGTCAATTGTGTGGTACATGAGGCATCACAAAATTGTTCGGAGATCTTATGACAAAGACCAACATACTTTCCGTCATGT
TCTCCTTGTGGCTCCTTGCCTTGTATTGGCTCTTGCTATACATGAAAAGTTTACCTTCAAGGAAGTAATGTGGACCTTCTCCATATTCTTGGAAG
CTGTCGCTATCCTTCCTCAGCTTGTCTTGCTGCAGAGAACAAGAAACATAGACAATTTGACTGGACAATACATTGTACTCTTGGGCGCATATCGG
TCACTTTACATCTTGAACTGTGTATACCGCTACTTCACAGGACCACACTTTGTACATTGGATAACCTGAATTGCACGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E345275] SGN-U575360 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156151 [Download] [View] Facility Assigned ID: TOFBY79THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0218 Quality Trim Threshold: 14.5