EST details — SGN-E345582

Search information 
Request: 345582Match: SGN-E345582
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141864Clone name: cTOF-18-C13
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
See unigene SGN-U564473 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C180279 [TUS-33-P5] Trace: SGN-T186776 EST: SGN-E374162 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E345582Length: 635 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E345582 [] (trimmed) GGGATTGCAATATCTGGTTCCGATGGTGTTCTTGAGCAGTGGAGACCAGAAGATTCTGACCCATGTGGCTGGAAAGGGGTACAATGTGACTCAAA
ATCAAAGAGAGTTACATCTTTAAGCCTCCCTAATCACAAACTGAGTGGATATATATCACCAGATATTGGGAAGCTAGACCAGTTGCAGTTTCTGG
CTCTTCATGACAATAATTTCTATGGGGCAATACCTCCTGCATTGGGAAATTGTACAAACCTGAAATCTCTGTTTCTTCAGAGTAATTATTTAAGC
GGATGGATTCCTGATGAGTTGGGAAACCTTCCTGAGCTTGAGAATCTAGATCTTTCAAGCAACTCTCTCAGTGGAAACATTCCACCATCCCTTGG
CAAGCTGAACAATCTTGGCATTTTCAACGTGTCAACAAATTTCTTGGTTGGGCAGATACCTTCAGATGGACACCTTGCCAAGTTTGGAAATGATT
CCTTTCTTGGAAATCGTAACTTGTGTGGCAAACAAGTTAGTCAGGACTGTAACAATGGAGGTCCTTCAATATCCCCGTCCCCGGGTTCAGCCCAA
AGCCAAAATAAGAATGGTCGACTACTTATAAGTGCATCTGCCACTGTGGGTGCACTGCTTTTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E345582] SGN-U564473 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T157303 [Download] [View] Facility Assigned ID: TOFCQ19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5