EST details — SGN-E345601

Search information 
Request: 345601Match: SGN-E345601
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C142045Clone name: cTOF-18-K11
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E345601Length: 671 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E345601 [] (trimmed) GATTTGTTACTACATGTTAGAATATACTAATAATAGTATTAAATTATTATTATTTTTACACTAGTGTAGTCTAGAGTAGTTTATTTTTTGGTGTG
TAGCATGCAAATGAAGAGTATTTTAGTATTAAAGTTTTGAGAGTGGATCTGAACTTGTATCTCAAAAATTCATAGTTCCAAGGCTTTAGTATTCT
CTGCTTTGCTCTTCAGCATGTGAATGATCTACCTTGTAAATCCATGGTAATTGTTGGAAAAGTAGAAGTATTCGTGGTGGTGAAGGTATTTTCCG
TAAGATTTTCAACAGTAGAAGAGTGAGAAAATGAGATCTATAGAGGATAAAGGATGTTTGAATTATGGACAAAAAGAACAAGAGGTTGTAGGAGG
CAGTAGTATGAATTTTGAGTTTCATGGAACAAATCGAGCTTCGACTCATCATAGAACAGCAGCATTAGGTAAACCAACACCATCAAAATGGGATG
ATGCACAAAAATGGTTAGTTAATCTATCAAGAGGAGAAAAACATCAATCGAAAGCCACACCTCGAAACTCGAATGCTGATGACTTAAGGTTGATT
GCACCTGTTCCAAAGAAAGAAGAGTATTCGAGTGACGATGAAGGAGATTCTAGTATGATTCAATTTGAAGTTGAAACAAAGAAAGTTGATTGTGA
TGAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E345601] SGN-U574112 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T157322 [Download] [View] Facility Assigned ID: TOFCQ66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5