EST details — SGN-E345673

Search information 
Request: 345673Match: SGN-E345673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141905Clone name: cTOF-18-D9
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180286 [TUS-33-P12] Trace: SGN-T186942 EST: SGN-E374328 Direction: 3' Facility: INRA
Clone: SGN-C180286 [TUS-33-P12] Trace: SGN-T186943 EST: SGN-E374329 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E345673Length: 660 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E345673 [] (trimmed) AGGAATCTCAGCTGAGAGGTCTACTTACATTGTCCATTTGGATAAGTCTTTTATGCCTAAAATCTTTGCGACTCACCAAAACTGGCATTCTTACA
TTATTGATACCATCAAGATTGAAGCTCCCACTACACAAAATACCCACCATCCACTTCCAAAGCTTCTTTATTCTTATGACAATGTCTTTCATGGC
TTCAGTGCTGTGTTGTCTAAAGATGAACTCGAAGCACTCAAGAAGTCGCCAGGCTTTCTTTCAGCTTATAAAGACAGGCCTGTTGAAGCTCACAC
TACACATTCCCCTGAGTTTCTTAAGCTCAATCCTGCTTCAGGGCTATGGCCGGCGTCTGGTTTTGGTGAAGATGTGATCATCGGTGTACTCGACA
CTGGTGTCTGGCCAGAATCTGCTAGTTTCAGAGATGATGGACTATCTGCAATACCAAAAAAGTGGAAGGGAATTTGCAAGCCAGGAACAGATTTC
AATTCTTCATTGTGCAACAGGAAACTCATTGGAGCAAATTATTTCAATAAGGGGCTTTTGGCTAGCGATCCTACTATCGTNCTCTCCATGAATTC
TGCAAGAGATACGAGAGGTCATGGCACTCATGTTGCTTCCATTGCTGCTGGTAGTCCTGTAAAAAGAGTTTCATATTTTGGATATGCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E345673] SGN-U581628 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T157394 [Download] [View] Facility Assigned ID: TOFCS17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5