EST details — SGN-E346796

Search information 
Request: 346796Match: SGN-E346796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C146466Clone name: cTOF-32-G16
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E346796Length: 657 bp (927 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E346796 [] (trimmed) GGGAGTTGTTTGTACCTTGGATCTCCAGCCATGATTCATTTTGTTCTGCTCATTAGCCGACAGGGAAAGGTGAGGCTAACCAAGTGGTATTCACC
ATATTCACAAAAAGAGAGAACCAAGGTAATCCGTGAATTAAGTGGTATGATTCTCACTCGAGGACCGAAGCTTTGCAATTTTGTCGAGTGGAGAG
GATACAAAGTCGTTTATAAAAGATATGCAAGCCTGTATTTCTGTATGTGCATAGACCAAGAGGACAATGAGTTGGAGGTCCTGGAAATCATACAC
CATTTTGTTGAGATTCTGGACCGATACTTTGGAAGTGTATGTGAGCTAGACTTAATTTTCAATTTTCACAAGGCATACTATATATTGGACGAACT
TGTGATTGCTGGTGAACTCCAAGAATCAAGCAAGAAAACAGTTGCACGTCTAATTGCTGCACAGGATTCTTTGGTTGAGGCTGCCAAAGAAGAGG
CAAGTTCTCTTAGTAACATCATTGCACAGGCTACTAAATGAGAGTATGCAGGCAGCGTTCAAGTGTTTTGAGTGCATTTATGTTTTTCAGCTGTA
ATCCAAACATTATTTCTTCTTTCAATGTTTTCGTTTAACTTTGTAGTTATAAATAGGAATTTCTTTGTAGTAATGAGTTTTCTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E346796] SGN-U572102 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T161207 [Download] [View] Facility Assigned ID: TOFEV44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0026 Quality Trim Threshold: 12.5