EST details — SGN-E346989

Search information 
Request: 346989Match: SGN-E346989
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C144286Clone name: cTOF-25-O3
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E346989Length: 420 bp (987 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E346989 [] (trimmed) GGAGTTCTGCAAAAGTAGGGTTTTCTTGCAAACACATCGCGCAGCCTCGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACCCA
AAGAACTACGGCCCTGGCTCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGCTT
CCGCAGCAATGCCAAGGAAATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAGAA
GACATATGGCATTAGAGCTTTTTGATTTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTGATTTATGTTTTAACTTTTGGAAGTAAC
TGCTATGTGAACCTAAGAAAGACTAGCTTTTAAGATTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E346989] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T159085 [Download] [View] Facility Assigned ID: TOFDS86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5