EST details — SGN-E347497

Search information 
Request: 347497Match: SGN-E347497
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C146698Clone name: cTOF-33-J22
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E347497Length: 205 bp (854 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E347497 [] (trimmed) GCCAACATAAGAATCATTGAGTTTGTAAAAATTCTTAGGGAAAAGCTTGGACTTGAATAAATAAACATATGCATATCATAGTAGTATTGAAGAAA
GGCACTTCATTCTGCCTTTATCTTGTGTTGTTTCAAGATTTGAAATGTTTGTTTGGTTATAGTGTAAGTTCTATTTCTAATAGTAATAAAGGATA
AGCTTGTGTCTTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E347497] SGN-U580842 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T161559 [Download] [View] Facility Assigned ID: TOFFB59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.865 Expected Error Rate: 0.0027 Quality Trim Threshold: 12.5