EST details — SGN-E347643

Search information 
Request: 347643Match: SGN-E347643
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C144654Clone name: cTOF-26-P9
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181574 is on microarray TOM1: SGN-S1-1-5.2.12.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181574 [TUS-37-F4] Trace: SGN-T194378 EST: SGN-E393052 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E347643Length: 593 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E347643 [] (trimmed) GGTTTCTTCAGCTGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACTGCTTCTTTCCCTG
TTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTTTGTGTGTGTATATATATATATGTA
CAACAAAATTCATTGACTATAATGCTATACTCGATTAGCTAATTTAACTATTTATAATTGTATAGGTGTGGCCACCAATTAACATGAAGAAGTAC
GAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATT
CGAGACTGAGGTTAACCTCTGTTTTTAAAATTTATATATTAGCTAGTGTGTTGATATGTTGTGTTAATAGTGTTGTGGGATATCATGTGCAGCAC
GGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTTGGGTGCACTGATGC
AACCCANGTCTTGGCTGAGGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E347643] SGN-U578019 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T159515 [Download] [View] Facility Assigned ID: TOFDY89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5