EST details — SGN-E348224

Search information 
Request: 348224Match: SGN-E348224
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C144885Clone name: cTOF-27-M13
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E348224Length: 691 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E348224 [] (trimmed) GAGACAATGTTGGGTTCAATGTTAAGAATGTTGCTGTTAAGGATCTTAAGCGTGGTTATGTTGCCTCAAACTCCAAGGATGACCCAGCTAAGGGG
GCAGCCAGTTTCACTGCCCAGGTCATCATCATGAACCATCCTGGCCAGATTGGAAATGGATATGCACCAGTGCTTGACTGCCACACTTCCCACAT
TGCTGTCAAGTTTGCTGAGATCTTGACCAAGATTGACAGGCGTTCAGGTAAGGAACTTGAGAAGGAGCCTAAGTTCTTGAAGAATGGTGATGCTG
GTATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCCGAATACCCACCATTGGGTCGTTTTGCTGTGAGGGACATGAGGCAA
ACTGTTGCTGTGGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGGGAAAGTAGAGTGC
ATTTGATGAGCACGGATGAAATAGTTTTGTTTATTTGCATCAGTTTTTTTCATTTTTGTTTTGGACAGCATTTTGCCAGTTTTGGATATGGCTAC
AGAAGGTATTGTCATGGTTCTCTAGCCTCTTTTTGAGGATAGTGGAGTAATTGAGCAATTATGTCGGGACCAAATTACTTGATGGGCAATGACAT
ATAGCTCTGTNGGTTGTTCCTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E348224] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T159828 [Download] [View] Facility Assigned ID: TOFEA79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5