EST details — SGN-E348835

Search information 
Request: 348835Match: SGN-E348835
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C145494Clone name: cTOF-29-N19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E348835Length: 674 bp (912 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E348835 [] (trimmed) AGCTATGGCGGACACCACAACAACAACAACAATCTCCGGTGACTCTATTACGGTTACCGATGACCAGAAAAACAATCCCACGAACCCACTTGCAT
CATTTATCTCTAGTGTTCTTCAGCTTTTCAAACCGCCGCCGGCATCTAGTAAGAAGATTGAACCCACCGCTGCTACTTCAGACCTCAAACCAATT
GCTTCAGCTGAAAAAGAGGAGAAAGCTGCTGTAGTGAAGTTTCCGCGACAGGATTTGCCTTCGTTGAAGCTCGAAACAGAAGGGGCTGAACCTAA
TACAAATCCCATTGTCTTGTGGCAGGTTTATGCTATCGGAGGGTTCTTTGTCTTAAGGTGGGCATGGTCAAGATGGAACGAGCGTCGTGGAAACA
GGAAGCCATCCGATGAAGAGCCTCCTCCCAGTCAAGAGTAGACTTTGTACTGCAACATGTTAGAAAAGAGAAAACAAAGAATGACACTTGTGGAG
ACAGGTTTATGACTTTATTTGAGTCTTGTAAAGTGTTGAATCACAGTTCTGGTTTTACAGTACTAAATGTAAAAACCCGAATCAAGCTTTACGTC
AATTTGCCAGTCAGCATCATTTTGTACAGCCTGTGTTTCAGCCCTTGTTGATAATTCTTGCTAAAGCAAGTGNATGCGTGCATGAGCTATACTGT
AAGCTCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E348835] SGN-U565853 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T160403 [Download] [View] Facility Assigned ID: TOFEK82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0093 Quality Trim Threshold: 12.5