Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E348905

Search information 
Request: 348905Match: SGN-E348905
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C145422Clone name: cTOF-29-K11
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E348905Length: 602 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E348905 [] (trimmed) GAGAAACCAAATGTCTTGGATAGAGATGAAGGAAATAGTAATTGGGATTTGGATACTCCAATTAGCTTTTCCAGGAGGCGAAAGAAGAAGAGTTC
TGTGGAGCAATTGCCTAAATGGTGGCCTGTTTCGACTTCTGGTTCCGATCAAGTTGGGACAGAGAATCAAGAAGAGTATCAGAGAATGGCCGATA
GATTGATTCGAGCCATCTTGGACAATAGAATGACGGGGAAGGACATTTTAGCGGATGATATAATTCAATTACGACGCATAGGGAGGGTATCAAAC
GTGAAAGTTTCATTTGATACTGAGAATGCACGTGATACCCTTTTTCGCGTGGCAGTCGACTTTATTCTTAATTATTGTGAAAGCACTGCAAGTCA
GTCAGCTTTTGTTCTAATTGATGGTGAAGAAGCACAAAACTTTGTTGCTGGGCTTGCTGATAATGTTGGACTTGAGAGTACTCGGGCTGCAAGAA
TGGTGTCTGCAGCTGTTGCTGCACGCACTANGTCAAGGTTCTTGCAAGCTTGGGCCTTGGAAATCAGGGAAAGCATTCTGAAGCTGTGGTGGAAC
TGTTCAAATATGTGTCATCCACCAGATATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E348905] SGN-U564207 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T160473 [Download] [View] Facility Assigned ID: TOFEI66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5