EST details — SGN-E349487

Search information 
Request: 349487Match: SGN-E349487
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C162988Clone name: cTOS-1-G5
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E349487Length: 692 bp (977 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E349487 [] (trimmed - flagged) GGACAAGAAGGCAACGTGGGAGGGTTGCAAAACACTTCGGGAATTTGGATTTGAATGTGGAGTTCAGTAATGAGGTTGAGGAGCCTATAATTCAA
ATGAGCCGAGAAAATGAAGCAGGAGAGGGAGAAGATGACACTGTTGAAGTAATTGGGTTTTTTGAAGGTCTTGATGAATTCCTTAGCAGTCTTCC
TATACTCAATGCTGTGGATGGTGATAAAGTAGAGGCTGCCTAGCTAAGTAAGACACTTCTTTTGTTGTAGTTGTAGCTATAATTTTTGTCTTCTG
GATGCTGTAGTTAAGAATGGTGTAGAATTACTCGGGCAGTGGTGTTGATGTTTCTGTTGTAATGCTAATTTCTTACTTTTCTCTTCCGAAGTAGC
TGCAGTAATCAGTTTACTGCTTCTATCTCCATGCTCCACGAGCTTCTTATTATTAGTCATCATAGTTTTCTTTAAAAAAAACCACAATCCGAGAA
GCAAAGAAGAAAAACAGAGATAAATTTTAGAAGGAAAATAAATCAGAATGAGTTCAAGCAGAAGAGCGTGGATAGTAGCAGCCAGTGTTGGAGCA
GTAGAGGCCTTAAAAGATCAAGTTGGATTGTGTAGATGGAATTACCCATTGAGGTCTTTGGCACACACACAAGAATAACGTGAGATCTTATTCTC
AAGCTAAGAAACTTTCTTCTTCATAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T161852 [Download] [View] Facility Assigned ID: TSCAA39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (ends match significantly different genes in arabidopsis)
Sequence Entropy: 0.954 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5