Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E350080

Search information 
Request: 350080Match: SGN-E350080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C165631Clone name: cTOS-4-B4
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E350080Length: 376 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E350080 [] (trimmed) GGTTGGGAAATATTGGGACTATAAACCCAATAGTGATGAAAGAGTCTCCACCAGAGAGGTACATTCAGATTGTTACCATCGATGGTCATGATTTC
TGGTTCATGGGGTTTGTGAATTTTGATAAAGCAAAACATCATCTACTTGAAACTTTGTCAATTTTTAGAGCACAACCCCCTCATCTCAATCTGCA
ACAACCAGCAGCTACTTACTAGAAGCATTGCCTGTACTCTGTTTTAGTGTGTTTTTTTTCCTGTTTGTTCCTGCATTAGATATGTATTTGTATTT
CTTTTATTGTAACATTACTTGTATGTTTATACATATTCGGGAGTGACTATGTTCGTTTTGATGTAAATAAAAGTTCTTTGCGTTTTAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E350080] SGN-U580380 Tomato 200607 Build 2 55 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T162694 [Download] [View] Facility Assigned ID: TSCAP02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5