EST details — SGN-E350701

Search information 
Request: 350701Match: SGN-E350701
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C166800Clone name: cTOS-7-I20
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E350701Length: 510 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E350701 [] (trimmed) GTGCTATTTGCCAGGAGAAAATGCATACACCAATCTTACTACGTTGTAAACATATATTCTGTGAAGACTGTGTGTCTGAATGGTTCGAGAGGGAA
AGGACGTGCCCTCTGTGCAGGTCTTTAGTAAAACCTGCCGATCTAAAATCATTTGGTGACGGTTCAACTAGTCTCTTTTTCCAGTTATTCTGAAG
AAATAATTGTCGATGAGAGCGAGTCTCTTCAAAAGCTGCCAACTTCACTAAAAGCAGCTATAGCTGAACCCCCCCCATCCATGGAAAGAAAGCCT
ATTGACACACTTATTTCAGAATCCTGATCTGTTTGCTCCTGAAAGTTGTCTAATTGGCTCAACGCAGGCCATTGTTTATACACAGTTCCACACAT
GGAGCAGGCTATTGTTCATACGTTTGCTCGGAGAAAATGTTTGTATCAGTCTATTAATCCACAGAATTGTCAAGTGTACAATGTATGAAAATAGT
GTTGTAGTCAGATATATATATATCTTTTTATCCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E350701] SGN-U580255 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T163654 [Download] [View] Facility Assigned ID: TSCAZ58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0030 Quality Trim Threshold: 12.5