EST details — SGN-E350985

Search information 
Request: 350985Match: SGN-E350985
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C166327Clone name: cTOS-6-C3
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E350985Length: 316 bp (924 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E350985 [] (trimmed) GATCAAAAGGTCCTAAGCTTGGTGGTGGCGGAGGAAAACGTTAAGCTGTTGTTTATGTTGTTTCCTTATTAGCAATAGAGTGCCTTGTTTGAAGA
GACTGTAAGCGGAGACCTTCATTTACAAGTATCTCATACATCTGCAGACAAATTTCTCGTTGACGGTTTTGCATTTGGTTGCAAATGCAGCTGTT
GATTCTCCACATACTATTGACTTCTTGTGGGTTCATTCTCTATTACAGATGTAGCTTTTTGACTCCTAAACAAAATATTTTTGAAATCTGTTTCT
TCGAAACTCTTGCAGTAATTTACCATGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E350985] SGN-U580929 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T163255 [Download] [View] Facility Assigned ID: TSCAU14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5