EST details — SGN-E351420

Search information 
Request: 351420Match: SGN-E351420
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C160365Clone name: cTOS-12-F23
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E351420Length: 337 bp (931 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E351420 [] (trimmed) GAGATTGTAGAGCTCCTCCAAAGAAATTGGTTTCATATAGCTGATGTTGCTGTGGAATGAAGAGATTTTGTGCATTCTTAACGGGTTAAATCAAC
TCGATTATATATATGCTTCAACTTTAAGCTAATTAGATATTGTTACTCGAATATTATGTATCCGTTCTGTTCTATTCAAACTCATGATAGTTGTC
GTTATTCTAATAGCTAGTATAATTTCACAAAAAAATGAGGGGTATTGGCTTGCTTTTTTTTTTTCTTTATTAATTAAAATGTATATAAGTAGTAC
AACTTGTGTATTAACAATTTATTTTTCACTTTCAACCTAATGTTTTGCTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E351420] SGN-U565201 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T165366 [Download] [View] Facility Assigned ID: TSCBU36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5