EST details — SGN-E351425

Search information 
Request: 351425Match: SGN-E351425
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C160432Clone name: cTOS-12-J1
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E351425Length: 320 bp (1063 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E351425 [] (trimmed) GGGAATAAAGATTTTTGAACTTCAAAAAGAACAAATTCAACTAATTTTAGAAGTGTCACGCACGATATATATTCCAGGATGGAGATTTTTGCCAA
CTAAAAGGAACAAAAGAATGAAGCAAATTTTCAATGAAGTAAGAACACTGATACTAGAAATTATCAATAAAAGAATGAGGATGATTGAAGCTGGA
GAATCACATGATGATTTATTGGGTATATTATTGTCATCCAATTTAAAAGAAATTCAACAACATGGGAATAACAAATTTGGTATGAGCATTGATGA
GGTGATTGCACAATGTACATTGTTTTATTTTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E351425] SGN-U578818 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T165371 [Download] [View] Facility Assigned ID: TSCBU49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.901 Expected Error Rate: 0.0174 Quality Trim Threshold: 14.5