Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E352050

Search information 
Request: 352050Match: SGN-E352050
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C160718Clone name: cTOS-13-H11
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E352050Length: 475 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E352050 [] (trimmed) CCAAATACAGAGTGATTGTTTTTCCTTCTTTCTTTTACAAAGGTATTTTTGTCAATCGAAATAATACGAAGAACAAGATAAAAGGGGAGTCATAG
TAATAATGCTAAAAACGATAACTAGACAAGTTTGACGTCCTATCAACCTTCCCAGATCATCGACCTCCATATGTCCAGCACTAATAGTACAAGTT
CGATTCACTGGCACATCGAGATAGTCTCACAAGAAAGAGGTCAGAGATAAAGTTAAGCAGAATTTACAGGTGTGTTTGCATGTTTAGATATACTT
TCGATCCTTCATAATAGTACATTCAAACTCAAAAAGTTGTTGCTACCACATCCCAGCGCCATATAGTCCCATCTTCACAACAGCTAAGTATGGTG
CTTCCATCAAAAGACATGGCAGTCTGTCTAATTGGTTGTTTAGATTGAACATGAGACAGCTTTGCAATCAAAGTTGGCGGGCTTGTTTGTACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E352050] SGN-U585084 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T165665 [Download] [View] Facility Assigned ID: TSCBY42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0131 Quality Trim Threshold: 12.5